Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544784
Length 705 bp
Fasta Format > rwhgc10d20
aggtattccacatcaatacaaggaaatactcccaggacaacagagaccac aaactagggtaggtaatagacataagctgtggcataggttcataatattg ccaatgaattatttaggagatatatatcatcatcatcatgactgaaaaca ggttccgaccaattaagccgcaatcaagcaaagatagtagcttaaagagt tgcaccagctcctgctcctccacggcggcactcgttcagcatgtcgaggt agaactggcacttgctgatgtcgcttccgtagtggttgatgcaatcttgg aaggccttggaagggttgccacacttgtcatcagcagcattgtccattgg agtcatagatgcagcagcctcaccgacaacagtctcatgctgaatggtgc ggggacccatcacagcatcaacagccctgtgcgccatggcactgccagta ccgaaagccatgccctgagcaatggtggacccaattccactcatgatacc accaccgctattctgggtagtagcaggtggaggagcttgacgggctggcg ctggtgggtttctcactggagcagcacgtggagcagggcgggaagacctt cctcctccgctgcggcgagccatggcggcggacggcgggaggaaacccta ggctggaggcggcgccnggaggggagaatgtatgaacaggaagccnacgg atcgg
Download
page-top