Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544782
Length 766 bp
Fasta Format > rwhgc10d18
agtttctcgccgaaagaaactaccaaagcatttccaagaatttcaaagaa accgcctcaagtcgattcagccacttcacaatgaggtcgccgtcgcctac ttgctggtctcaaggttgccatcgccgctcatcactggcagtctccagcc gctctccgtcgccacttgtgccacccatgtgctcgctggtcgctggctgc gccttccgctccctgctcgtggattggcagaacaagaagtgcctgaagca aatggcaaagtgcagttatgcaggagatccaatttacagtacctaatcat tcaaagctttgactgggcgtttgttcttttagcaatttttttgctataat ccaatgttatggacatgctttattggtacgaggaaagcaggattgatgta tatcagaacttgctgtactttctgtatcaaggaatgaaattatgtggttt ggaagcattttttcgaaatgtgcagtgttcaagattcaactggcttccag aattatagaactgaggttgtgagtggaactaggataaattaataagattt aacaattgcttttagattctacttactctgtactgaataactggaaatta ctactccaataagtaacaactccctaactccatctagaagttggacactg actctcagttatactgattcagtcataccttacatttagctactttcaga aatcaaatcatcatccaaacgcaaactgtgtggcacagatttcacgtacc atgtacacatacggat
Download
page-top