Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544779
Length 719 bp
Fasta Format > rwhgc10d12
taagatagcagcagacacaggaagataaccaaggcggccggacagagatc cagcagcccaaagagtccacctaaaaccctcctaaaccaaccacggagat ctcatcggacggaccaggggaagacacgacacgacacacgactctcttat ttagatcgacgacacgacacgggacacacggggcggcgacgacgacggcg aaaggcgacccgcgcgcgggcggatctagagctggccgcagtcggcgatg accacctgcttggagcaggtgccgctgcgggagcccaccttctcgatgtt cttgacgacgtccatgccctcgacgacctcgccgaagaccacgtgcttgc cgtcgagccaattgcaggggacggtgcagatgaagaactgggagccgttg gtgttgggccccgcgttggccatggagaggatcccgggcttggtgtgctt gtggacgaacttctcgtcggcgaacttctcgccgtagatggactcgccgc cggtgccgttgccccgggtgaagtcgccgccctggcacatgaagtcgggg atcacgcggtggaaggcgctgcccttgtagtgcagcggcttgccgctctt gccgacgcccttctcgccggtgcacagcgcgcggaagttctccaccgtcc gcggcaccgcgtccttgtacagctccatcacgatgcgcccggccggcgcg ccgccgacggtcatgtcga
Download
page-top