Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544777
Length 755 bp
Fasta Format > rwhgc10d09
atcagcatctacagaatcgcttgcatgtttgacaataatatgcgatggtg cagtaaaagctcgttctgttcacaatgaaagcatgacaggtaatggcgac ataaccaaaatgacttgaatcgatgagtaatgactattcaagcattgaag tggaagaggtctttcacagtcttgatttgagctcagcagcaacagcgtca atgaactcttcagtgttcaggtaatcgcttcttgtaacttttgaggatcc atggacaaggagtgcaaggtccttggtcatcttcccagactccacagttc cgacgcacgcttcctcaagtttctgtgcaaattcaagaagtctagcattc tcgtctagctttgccctgtgtgcaagtcctcttgtccaagcaaagattga agcaatgctgtttgtgctggtttcaccacctttctggtgaacacggaaat ggcgggtaactgtgccatgggcagcttcagcttcgatggttttaccatca gggcacatcaatactgacgtcatcaagcccaaagagccaaaaccttgagc taagaaatcactctgcacatctccgtcatagttcttgcaagcccaaacat agcctccttcgctcttaagtgcataggcaaccatgtcatcgatgagacga tgttcataccatattccagcagcctcatatttggatttccagccagcttc atagatctcctggaaaatgtccttgaacctgccatcatatttcttaagga tggtg
Download
page-top