Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544764
Length 765 bp
Fasta Format > rwhgc10c15
ataatcttacagacttagctgtccgaccaaacagatctcctgcgtgttcc cgaaagaaaagaaaaaaaggctgcggttttagcataaattctcggtagta ccatcttagcaacatttcccaagtcaagctttcgtgagagggacgaagcc gtgcctgatagcagccgaccatgccttctcagggtccatcatgtcgtcac cgcactcgtgcacgctccacccttccaggacgtgaagtattccggcgata tgccacgcgctcatcacccttctcggcagccagttctcgcaggagtggat gttctgcatggtgtccgggatcttcatcgccggagtgctcaagtaagtgc agtccttgcggactttcttaagggggaactgcgatattggaatgaacact gttccttttggtgccatcctctgttctttgtcgtcgatcctctctactag ccaaatcttggttatgtcattgctggagcacttcaagtagcttgctctgt tctctggcatctgtgacttgagcatgtcatactctttcttacgattcatg atcacctggatgcccttgccacataaagccatagcaacggcacgggctat cttagaagtccctgtatgaagaaaaacttgctttgcatctgaagggatgc tttttaggacaactccagttgctaagccacttccatcaacaattcgaact cctaattttgggtatttttgtctaaatagttcaccattcccattgagctg ttttgcctgatttag
Download
page-top