Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544762
Length 531 bp
Fasta Format > rwhgc10c13
ttcttagcctggagattgagccaaaattacttctagcttagaaaccacat gccaagcgtgaatgacaatagttaatccccaggaccgggaggcgatcgaa cagcagagccccaggtgaaacttaagtacataagatatgccattccgtac tccacaaccactatccagtcaagttcatgggctagaccctttcttgaaca gcttgatttggtcaccatagtagtacgcgctgccgaccatcagagcaacc gtaacgccttgagcaaccacacgggccctcatcagcttctgacccagccg agaattcccgtaccggaagctgaccaggccagctgtcaggacacccgcag tgaccaatgcaccgatggggacgaaggggttcttgacgggcttcttcccc tcgaacgggaactcgtccagctgcggcatcggcggtggccgcgcgctgct tcctgcggcggcgccggagcccttctccattcgcgtcgcctgggaggaaa aggggggaggggggacgcttttccgaacagc
Download
page-top