Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544754
Length 789 bp
Fasta Format > rwhgc10c01
atggggctccctcccgagccagaccaggtaggcagccaccgcctgctacg ctacaagcggcgacagcaaccttccccggcaacatcacatacgggggagc ctcaaatcttgcgacaacaaccataacacggctacgacatatccagacca cattgcaatgtcattgacagtagcaaacactagctaggagcttgcggggc gtcgcaaagccggctttactgcccctcgctcgagtcgttctttggagcct ccctgatctcctcctccgcggtgtcctccgtgatgtcagaagtccagagg gtcaagttatcacgaaggagttgcatgatcaaggtgctgtccttgtagga ttcttcgctcagggtgtccagctccgaaatggcctcatcgaatgcctgct ttgcgagattgcaagcacgatcaggcgagttgaggatctcataatagaac accgagaagttcagtgccagcccaagcctaatcggatgagttggagccag ctcagccaaagcaatatcctgagcagccttgtatgccaccatggtattct cagcagcatccttcctctcaggcccactcttgaattcggcaagatatctg tagtagtcacccttcatcttaagatagaagaccttggactcaggggcagt ggaagacgggacaaggtgggtttcgagcagcttgaggatgccatcacaga tcttgctaagctcagtctcgatcttgccacggtactccttgatgagcgtg acccggtcctcgttgccacggctctcctccttctgctca
Download
page-top