Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544752
Length 247 bp
Fasta Format > rwhgc10b21
gatctacnaagacggacaggcgcgaatgtatgcaatgctgcaaaatcaat tggtcaactgaagaaaacaacattggataagatacaagtacacttattta catgacatacaaagttctctttcccagattttctggatcaatttgattgc aaattttgcaaccaacattgtatacaacgggttgtggtagtgactaagga tctggtttgcccactatatcctcatcgccggagtcatcggcacgagg
Download
page-top