Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544751
Length 617 bp
Fasta Format > rwhgc10b19
gattagggacgcacttttagttgggtaaaaatatcatcaatttgctccag gggcgccagaaataaatcacatgcacaggcatttaaccatacatggagta gctaccttgggatcaggatagatattacacttctgtttctgaaactgacc ccaaaagaccacaccacgcacgccagcaataaacacactaggctggtatc ttggatatgggaatcaaacctatgatttctgcaatcttgagcttcttcct ggcataatgcacatacctccttggcagatcacacttgaaactaacttcct gcgaaattaacacacgcgctagccactctggaacttccttattgacgccc gctgtgcaccgtcgaaattttttctccaatcccaacgagacaggttgact cagctcgtgctccaaatcacgtttgcgtaatggaaacaggttctcctcat acacatgcttcatagcatctctcaaagacatctgatcagacccattgacc agcttccaaatctcaaaaaacacagagtcaagatctttcacggactcgag ataattgctcgttgtatactcctggaaaccataatatgctagccccagag gaatgttttcgaaccta
Download
page-top