Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544745
Length 777 bp
Fasta Format > rwhgc10b07
ttaagttcaaacctgaatttaatttccatttgactgcaatcctcggtatt atatgttctgtctctacaaagaagaaacgcagtccacaaaggacacagac cttattgagcttagggaaaaacaatgtatatagttctcttctaattgcat aaatatagtcttctctctctcactagttttcatatataagctctcgactg agttccgctcggtgtccaaaactttcatatctaaaccatgactgcgccag tgccttctctcatctaccgacgcggcgggggtctcctcccgcctggagct tgatcttcctcgtcggattcgacgtctccatactgccacagccgcagcct ttccttcttcgccttctcctggaactgttccaggttctcgagagctgtct tcctctccttggtgtcccatctcttgcccctttcaagtcgggcaagccct tcctcgagcatggcagcattgatgctggattctgtctctggatcaacaag agtcacaatgagtacaggtccagtgccttgtcccttcactttaccaccag tagtgtcgcgctcttcgatcattgcccggtattgttttgaactgctcagc aagcattcgctgagatactctgctgcttcctgaccattatcatcctccag accaggcacctttatgaaggcaaggctgcagagctgagcaagaggaggag aggaggatactgatgggtctgcaggccggatgcggttgtaaggaaccact tcttggttgccaaaatcaatgtagaat
Download
page-top