Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544739
Length 709 bp
Fasta Format > rwhgc10a22
tattctttcacggtgacgggcctttaactatatcctagtatattagaata taaccaagggatgattggtgaactatgcatttggaatttagaacaaattg caagcatgagaatttcaagcagcaaccctgaaagtgaccaaagctttgtg atgataaagattagccacgatcaagagtagagaaaatctttgccaatgat tcgtatgtgagatcatgattcaagagtagagaaggttgtcggcagtgcag tttcgtgtggactggaccgcgtacctcgttggatataagaaatataaaca attccggattgccagcagcatgccacctgctgccaaagagaggaaggtgc gtgagtctatcccaaataaaaataaataaagggatctggatgctccaggg gagaggaatacagggattatatgaattgaatgaaaaacaacggcnatggg gaaaatccccaacttagctgccatgtgtttatcagaatgatgcctctgca cggtctttggaggcatgcggtggttggggtcgtggcaaggcagccgcagt ggtgtctacaggaggagcgccgccgcttccgatatgggttcttggcagtt gtccggtcggcttggcagacatggacggccaagtgagggaagtagttcgg ccggcttggcagacacggactgccgggggagggatcgagggaggcgccnc cantgtgga
Download
page-top