Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544736
Length 563 bp
Fasta Format > rwhgc10a18
ctgagtactgatgagattacatacaagtctgggtccaggttcaggtgaat acagagtacatcaaacttggaagacaaattggaattccacagtaacacgg atgacgggaagagatatatagccgccccatcanaaattcagaacacgcag cttgctcttcgggttgggttggcatcttctttgtagcaggaagaacagct gcttaggacttggtcttgaacgggatcgctctgatgaccacctggtggta gacggcagccagcgcggcgccgatgaaggggccgacccagaagatccagt ggtctgaccaggcgtgctccctgttgtagatgatggccgcgccgaggctc ctcgccgggttgatgccggtgccggtgatggggatggtggccaggtgcac caggaacacggcgaacccgatgggcagcggggcgaggatgggaacgtggg agtccctggcgttcctcttggcgtcggtggcggagaagacggtgtagacg aggacgaaggtgccgatgatctcggcgccgaggccggagcccttggtgta gccgggcncnacc
Download
page-top