Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ544733
Length 758 bp
Fasta Format > rwhgc10a15
gtttgttcttgagtaaacccttttactgctaaagtaaatccctgtaaccg aaaaggtaaacggctgagaaaacagatatcagatgttgttcaacattgaa ccaaaacagataatctattgccgctaaactttcactgccatctctctgat ctctatttctctttgtctttcttcacttctctcttgtggcaggcggtact gttgtactactgactacacccccaacaatggcagggctggggcacgtggg tcatcaccattaagaggagaaggctgaaagaatgttcttcttgatggcga attcatcggctttggaaggactgatcgacttctccaacaagcgatgaagc ctctcagtttccttcttggtatagtcagagcccttctgcaatatcttctt tgcaacattcacatagatctttccatgcttgacagcaggaccactgagct tcgcagcctcctcttcaattttagagaggatttccttccgcttgtcatca gcagcactgtggaattccttgacaagagcatccaaacttgccacaagccc agcctctgaagtaagctgaccctttgaatcacggctagttccacttttct cattaatgaacttaacaaagtcatccaactcccgaccgctctcatactct tcaccagctttgttacccttcgggaagaacttcaatgtgggaaaaccaga aactccntacttctcagccnagcttgtgtatttgtctgcatcaagataac caatcacg
Download
page-top