Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ289830
Length 663 bp
Fasta Format > whsl7f24
ggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgg cccccggcgatgagcagcccaagnatctaccgcatgaagctctgggccac caatgaggtccgcgccaagtccaagttctggtacttcctgaggaagctca agaaggtgaagaaggccaacggccagatgctcgccatcaacgagatcttt gagaagaaccccaccacaatcaagaactacggcatctggctgaggtacca gagcaggaccggttaccacaacatgtacaaggagtaccgtgacacgaccc tcaacggcggggtggagcagatgtacacggagatggcgtcgcggcaccgc gtgcgtgccccctgcatccagatcatcaagactgcgacggtggacttcaa gctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagt tcccgctggtgtaccagaaggttcgcccacccacccgcaagctcaagacc acctacaaggcgacgaggcccaacctcttcatgtgagcgggtccctactc tactggcctgtgtgttttagcgtgtaagagtttgaagatttttgcatgtg gaagttttggttaagcacttagatgatgttttcggtcgctaaggatgctg ctgctttgatgca
Download
page-top