Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ655682
Length 656 bp
Fasta Format > whgc3d11
tcagtatcctgatgttaaccatgccactgtgaagactcccagtggagaga agcctgttcgtgaacttgttcaagatgatgaatggctaaatggggagttc attgccactgtccagcagcgtggtgctgcaatcatcaaagcgaggaagct ctccagtgctctctctgctgccagctcancttgtgatcacatccgngact gggttctgggaaccgctgagggaacatttgtttccatgggtgtgtactct gatggttcatacngtgtgcctgctggtcttatctactccttcccagtaac gtgcagtggtggtgaatggacaattgttcaagggctcccgatcgatgagt tctcgaggaagaagatggatgcgaccgcccaggagctgtcagaggagaag gcgttggcctactcatgcctggcgtaaatccacattcgaagggcagctgc tcctctggatgttttgaataaatgaaaccttccgctctttagaaactctc gtctccacccagaacagccgcacatcgcgatgcatgctccttttcgctgg ttttccaagtgtgtatgaatgaggcttgtagctccccttttgcctgatga tttacaggacagtacatttgctgcaagagtgaaacaatttgacacctgat taaaaa
Download
page-top