Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ655189
Length 736 bp
Fasta Format > whgc20b07
ttttgaggctggtatctccaaggatggccagacacgtgagcacgccctcc ttgctttcactcttggagtgaagcagatgatctgctgctgcaacaagatg gacgccaccactcccaagtactcgaaggctcgttacgaagaaattgttaa ggaggtctcttcgtacctgaagaaggtcggctacaaccctgacaaggttc ccttcgtccccatctctgggttcgagggtgacaacatgattgagaggtcc accaaccttgactggtacaagggcccaaccctgcttgaggcacttgacca gatcaacgagcccaagaggccctcagacaagcccctccgtcttcccctac aggatgtttacaagattggtggcattggaactgtgcctgttggccgtgtt gagactggtgtcatcaagcctggtatggttgttacctttggtcccactgg tctgacaactgaggtcaagtccgttgagatgcaccatgagtctctcctgg aggcgcttcctggtgacaacgttggcttcaacgtcaagaacgttgccgtg aaggatctgaagcgtgggtttgttgcatccaactccaaggatgaccctgc caaggaggcagccaacttcacctcccaggtcatcatcatgaaccaccctg gtcagattggcaacggctacnccccagtgctggactgccacacctcacac attgctgtcaagtttgctgagctggtgaccaagatc
Download
page-top