Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ654907
Length 704 bp
Fasta Format > whgc19o06
tcgtcacatttgaccccaagcccatcccaggcgactggaacggtgctggt gctcacacaaactacagtaccgagtcgatgaggaaggacggcgggttcaa ggtcatcgtggatgccgtggagaagctcaagctcaagcacaaggagcaca tcgccgcctacggcgagggcaacgagcgccgcctcaccggcaagcacgag accgccgacatcaacaccttcagctggggcgtcgcaaaccgtggcgcgtc ggtgcgcgtgggccgggagacggagcagaacggcaagggctacttcgagg accgccggccggcgtccaacatggacccatacgtggtcacctcgatgatc gccgagaccaccatcctgtggaagccctgaagccgatcggcgccgatcgc cgtgcgatgatcagtgatgggttgggttggatttggtgggtggccactgg aggatttggacgaaattcttccaacatatttgattttccgtttggttgca tactacgcgtantccgcttangtaggtcgcatcatcgtcgtcntcntcat gcatcanggtgtctggtcnctcttctctcntctctnggtggtgggtggca anangcntgtcaaacacacnangctactattgattgttttcccttgccnt ttgggtgctctggtcctcntgtaatcatcanttnatatngtaataanatg gtcc
Download
page-top