Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ654836
Length 715 bp
Fasta Format > whgc19i13
cggcgacacacgcagacgcagatttggcattcagaaaaaattgaaattgt gaactgtgaagatgacggcaccagcggagctttcccgtgaggagaatgtg tacatggctaagctcgccgagcaggctgagaggtacgaggagatggttga gttcatggagaaggtggccaagaccgtcgactccgaggaactcactgtgg aggagcgcaacctgctctctgttgcatacaagaatgtgattggagcccgc cgtgcctcatggcgcatcatctcctccattgagcagaaggaggagagccg tggcaacgaggaccgggtcacgctcatcaaggagtaccgtggcaagatcg agactgagcttagcaagatctgtgatggcatcctcaagctgctcgaaacc caccttgtcccgtcttccactgcccctgagtccaaggtcttctatcttaa gatgaagggtgactactacagatatcttgccgaattcaagagtgggcctg agaggaaggatgctgctgagaataccatggtggcatacaaggctgctcag gatattgctttggctgagctggctccaactcatccgattaggcttgggct ggcactgaacttctcggtgttctattatgagatcctcaactcgcctgatc gtgcttgcaatctcgcaaagcaggcattcgatgaggccatttcggagctg gacaccctgagcgaa
Download
page-top