Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ654411
Length 725 bp
Fasta Format > whgc17k20
aggcgaaaggccatggggagagatttttctgtgatccatggatctccgat cgggaaaccgtatccaagctccgtggctagtctgcgctctttggactttt caaacttagcgaactgaaacatctgagtagctaaaggaaggaaaatcaac cgagaccccgttagtagcggcgagcgagagcggaacaagggttttcatca aaagaaatccgaagcggtttcattcgatttgttgtggattggatgatgga aaaaccagcaagcagcaagcgtagttagaaaagttgccgtagcgcgccct acggagttgtacaaagtcagcaaccgttttggggcgcaagcataggcaac acaggactgatgacggggtggggcgcgcagtgaactggttttctaaaaag attggaagatccggccaaagaaggtgatagccctgttcattcgttcccat ggttcgatccttcccagtaaaacgcggcgtgttcgaatgatgatcgcttt tacgcgagaaagggggaccaccctctaagcctaagtattcctcaatgacc gatagcgtacaagtaccgtgagggaaaggtgaaaagaaccccaatcgggg agtgcaatagagaacctgagatccgatgcgaacaatcagtcgaaggagcg gagcgcgggcgcactcactctaacggcgtacctttcgcatgatgggtcag cgaggaaatgggaacagcggcttaa
Download
page-top