Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ289691
Length 531 bp
Fasta Format > whsl6k07
gagtaacaaagccgtacgtagcgcaagcagagtttagctcgctcccagcc cggccgctcaccatgtggaccaagaaggtggcgacgcaggtggttttggt cctgcttctcctcctcatcgcacaggaggcggcggtgccgggggcggagg cgaagatctgccggcagcgcagcgcggggttcaaggggccatgcgtgtcg gacaagaactgcgcgcaggtctgcctgcaggaacgctggggcggcggcaa ctgcgacgggcccctccgccggtgcaagtgcatcaggcagtgctgatcat atgtggaatgctacggctagctggccctcgccgtacgtcagctagctagc ccatggagccatacgtctgtgtacctacttgaatgtgtgtgtgtgtgtgt gtgcccccttatacgtacgtatgtcgtatgtatatccgtgtcgccactag ccagctgctgcatctcgatcgatgcatgcaagataataatatgaatgaat aaaaacgtacggttcatgttcaaaaaaaaaa
Download
page-top