Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653757
Length 519 bp
Fasta Format > whgc14n17
atcgttcttatcgcctcgaacgtatcgaagccgaggagagcggagcagcc gacgagccgatcgacatgggtctgcaggaggagtttgaggagtacgcgga gaaggccaagacgctgcccgacaccaccaccaacgagagcatgctctgcc tctacagcctctacaagcaggccaccgtcgggcccgtcaacacagcccgc cccggaatgttcgaccttaagggcaaggccaagtgggacgcctggaagtc cgtcgaagcgaaatccaaggaggaggcgatggcggactacatcaccaagg tgaagcagctgctcgaggaggctgccgccgcatccgcttcttcctaggcc acagaacctacttttatccatggtggtgcagacatatgtgccaataaaca caaataaatttgaagtgctatctgtctaagcttatcgtcgtattgggtgt aattacgttgaacaagccccgcctgtgatatttgagtttacgccatgatt gattcatgtaananaaaaa
Download
page-top