Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653652
Length 663 bp
Fasta Format > whgc14h04
gggcgatcctcccggtgaactgaccgttaccccaaaccgacacaggtgaa caagtagagtatactagggcgcgtcgagagaaccatgtcgaaggaactcg gcaaaatgaccccgtaacttcgggagaaggggtgctctcctatcttttga ttaggaaagcggcacataccagggggtagcgactgtttattaaaaacaca ggactctgctaagtggtaacacgatgtatagagtctgacacctgcccggt gctggaaggtcggaaggagaagtgtgataagctttgaatggaagccccgg taaacggcggcagtaactctaactgtcctaaggtagcgaaattccttgtc gcataagtagcgacctgcacgaatggtgtaacgactgccccgctgtctcc gacatggacccggtgaaattgaattctccgtgaagatgcggagtaccaac ggctagacggtaagaccccgtgcaccttgactatngcttcgcagtgacaa ccttgatcgaatgtgtaggataggtgggaggtggtgacacacaacgacca atcctgaaagaccactctttcgtctaaggatgcctaaccgccgcaccgat cattcggggggggcgggacactgcnaggtgggtagtttatctngggcgga tgcctcctaaaga
Download
page-top