Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653632
Length 656 bp
Fasta Format > whgc14g04
gtcctcgcctttttcatcttccgtaggggcctttagtcttttgattagag tggaggtcgcgagagagcagagcgtaccgccctgccatagtcgcgaggat cttaatagtcggtcgcgactgttgtcatagtcaacgacggttgaaacttc caggaaaaaacttcgaattgggagggcgatcctcccggtgaactgaccgt accccaaaccgacacaggtgaacaagtagagtatactagggcgcgtcgag agaaccatgtcgaaggaactcggcaaaatgaccccgtaacttcgggagaa ggggtgctctcctatcttttgattaggaaagcggcacataccagggggta gcgactgtttattaaaaacacaggactctgctaagtggtaacacgatgta tagagtctgacacctgcccggtgctggaaggtcggaaggagaagtgtgat aagctttgaatggaagccccggtaaacggcggcagtaactctaactgtcc taaggtagcgaaattccttgtcgcataagtagcgacctgcacgaatggtg taacgactgccccgctgtctccgacatggacccggtgaaattgaattctc cgtgaagatgcggagtaccaacggctagacggtaagaccccgtgcacctt gactat
Download
page-top