Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653378
Length 711 bp
Fasta Format > whgc13g07
cagctgctcttcgtatcaccgatggtgctttggttgttgttgactgtatt gagggtgtctgtgtgcagactgaaactgtgctgcgccaagctcttggtga gaggattcggcctgtcctcaccgtgaacaagatggacagatgcttccttg agcttcaagtggaaggcgaggaagcatatcagactttctcccgtgtcatt gaaaatgccaatgtcatcatggcaacatatgaagatgtgctccttggtga tgtccaagtgtacccagagaaggggactgttgcattctccgctggtttgc atgggtgggctttcacccttacaaactttgctaagatgtatgcctccaag tttggagttgatgagtcgaagatgatggagaggctgtggggtgagaactt ctttgacccagccacaaagaaatggacctccaagaacactgggacagcta cctgcaagagaggtttcgttcagttctgctatgagccaatcaagcaaatc atagccacctgcatgaatgatcagaaggataagttgtggccaatgttgaa gaagcttggtgtgacgatgaagaatgatgagaaggacttgatgggcaagg ctctcatgaagcgtgtgatgcaaacttggctgcctgccagtcgtgctctg cttgagatgatgatatttcaccttccctctccctcaaaggcacagaggta tcgtgtggaga
Download
page-top