Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653357
Length 496 bp
Fasta Format > whgc13e21
gatccgggagtcccgtgtggaagggctctcgctcaacggatcaaaggtac gccggggataacaggctgatgactcccaagagctcttatcgacggagtcg tttggcacctcgatgtcgactcatcacatcctggggttgaagaaggtccc aagggttcggttgttcgccgatgaaagtggtacgtgagttgggtttagaa cgtcgtgagacagttcggttcctatctaccgttggtgttaaagggagaac tgcgaggagccagccctagtacgagaggactgggctgggtcaacctatgg tgtaccggttgttatgccaatagcagcgccgggcagctaagttggtatgg aagaactgctgcgccgcgggaaatccttctctatacaagttctcgtacga ggtttttgaacagaacttcgataggcgagaggtgtaagcaccgcgaggtg tgaagcgatctcgtactaaacgaaaacaaaaaaaacnaaaaaaaaa
Download
page-top