Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653314
Length 432 bp
Fasta Format > whgc13b23
ttctccaaccgcgcgacatcgtcaatatcgagcactgctgtgaccggcga gatatcgaagatggcggcccaggcggtgggtaattcagtctccgagttcc agtcgggtttcagcgacatgaggtcggacatggcagcgagggtttctttc aagtacgggtgcacgagaggggtggctggcgcgccgttcttcttcgtgaa cggcttcctccagcccggaggcgggtcgcccatcgacttcagcacgtgga ccagcatcctggagcccctcgtcgcgcatcacggccagaccatcgagatg ttcacttcggtgtaatgtaagcattgcaatcgccttttatatgtttggaa ccaaaggatggctattgtacagacagcagccctgtgtgtgtaaaccggtc gacagtagtattttgttcttctaaaaaaaaaa
Download
page-top