Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653235
Length 632 bp
Fasta Format > whgc12m02
tgctacccccaccaatgagggatgttcccatgcaaatgccatatcctgag atggtttacatgccaccaccaccaccaccactgggagtacctatgatggc tcctcctctctcgcctcctagaggttttgctgataacaagagcacagtgg aagtttgcagggactacttgaagaaaatgtgcaatagagaatcatgtaga tttgcacaccctgattcacaaactgaggtggcacatgacaaggttgaagt ttgccgtgattttaaacgaggagaatgcactcgacctacatgccgctttt accacccatcctcaagctgaagttctgttagataaatctttcatgccccg ctctgctgctgctgccgccgccgctgctgctaatcctgctaccgctgcga aagagctgctgcgctggctgttatgatgctaaggtgccatagagtatgag accgtcgcaagtgctatgtctctggaaggaaaacaaaacttgttactatc gtgtgatgttcagatggtttgcttgaacttgactcagctccgaagtagtc ttcttcacaatggactttgcatgtgcggttggtgtatttgcgttcataaa gatgttttagacttttcgctgcaaaaaaaaaa
Download
page-top