Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653203
Length 653 bp
Fasta Format > whgc12k01
cactctccctatccccgtgtccagaatctaccccccggctccaatggcgg cgaaggaaccgatgcgcgtgctcgtcaccggcgccgcaggacaaatcgga tatgctcttgttcccatgattgccaggggagttatgcttggtgcagacca ncctgttattctgcatatgctggatattgaatttgctgctgaagctctta aaggcgtcaagatggagttgatcgatgccgcatttccacttctcaaggga gttgttgcaacaactgatgttgttgaggcttgcactggtgtgaatgttgc ggttatggttggtggattccccaggaaggaaggaatggaaaggaaggatg ttatgacgaaaaatgtttcaatctacaaagctcaagcatctgctcttgaa gctcatgcagcccccaattgcaaggttttggttgttgccaacccagcaaa caccaatgctctcatcctgaaggagtttgctccatctatccctgagaaga acatcagttgtttgacccgcctagaccacaacagggcactcggtcagatt tctgagagacttggtgtccaagtttctgacgttaagaatgctattatctg gggtaatcactcgtccagtcagtatcctgatgttaaccatgccactgtga aga
Download
page-top