Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653166
Length 700 bp
Fasta Format > whgc12h20
gcctgccccctcccccagtccccaaatccgtagtcccgcgcgccgcgatg gaggcgagcaagctcaaggcggccaggctcctggagcagatgagcgccca cctcgccaccgacgccggcaaggagatcgccaacaaggtcggcttcgtct accagctcaacatctcgcccaaggtatgtatgatatcctcctatccctct gtttcccccatggaatccgcctaaagcttggtgccctcggcctcgggggt tcgatctgataacagaagatgggcgtggacgaggagatcttcgtcgtgga cctcaagaagggcgccgtctccacaggtcccaggtccccccgccgctcga ttcgtcccgcgcgggttctgaatttcggtttcttgggccgtgtttcctga agaaattcttcctctgctgtggtctcggcgtgcagggaagtacgagggga cgccggacgcggccttcaccttcaccgacgacgacttcctcgccatcgcc agcggcaagctgaacccgcagatggcgtttataaggggcaagctgaagat caaggggagcatcagcgccgcgcagaagttcacgccggacatcttcccca agccgtccaagttgtagaacgccgggttgccgtgccttgccccagtgatc ggttaataaaagagtcagttatgctcgcgatggcaatttggtgtgaccag
Download
page-top