Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653149
Length 704 bp
Fasta Format > whgc12g09
acgatgagccgcgaggccagcggcgcgtcggtgagctctgccccggtgcc cgagccagagcggcagcaggggcaggggaaccaaggggaggaggcggggt ggacgccgctggagaaggtggcggataaagtggaggagctgtacagtctc cgtgacaccttcttcccccgagacccctccgagaagtctgcgtccctccg cgcctgcgccgacgccgccctgggagtcctcgattccctgcctcccgagc aaagaaaatccccagaagagcgtgttatttatgaatttttgatggggaaa atactcgatgtcttcccagattattgtaaggaggctgaagagcatttatc caaagcagtaaagctgaatccatctcttgtggatgcatggctatgtttgg gtaactgcatctggaagaaggggaatttggcatcagcaaggaactgtttc ttattagcactaagtaagggcacagataagaaaatactatgtcaactctc aatgcttgaaaggagtatggctcaatctagtgaagaccaagcgttgttag tggaagagagcattaatcatgcaaaagaagctgtaatgctggacataaaa gatggaaattcctggtataatctgggtaatgcatacctcacaagcttctt tgcgagcggagcctgggacaaagctaggcttcatcattcgatcaaagcat atca
Download
page-top