Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653119
Length 421 bp
Fasta Format > whgc12e03
cggatgagctatcagctttatgatacccccggatatatacacattctttc cagagccgtgggccggcttggattacatttcttgagtaggcataattgga gatctagctgcaattgcatttgatggggacaggcacctgagagagataaa tggtgccatttgttaggtgataatatacacagattggcatgatttgccag ttcttttgttgttgtcggaaaaataagcagcatgtgattttgtgttgtac atatgataggagttagaagaaaattacacccacgagtagagttttttctg tttctgaattgtgcttgcatgtgatgtgatgcatatacatacattgtgac ggtgcttgtcagaagttcttccattgtaatacacagtttggatgatttgg ttgagctgatgaaaaaaaaaa
Download
page-top