Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ657050
Length 556 bp
Fasta Format > whgc9d17
atcgagctcgccagcagctgctacgcctggttcggcgaccactacgtcta cttcgacaagaacctcagcggcaccatctcccacggcgccatcaccaacc tctccggcgtcatggccaagaagctcttcatctgggtctccatcaccagc atgaccgcgcacctggagcgcggggtgatcgagttccgcgccggcttcat cacggaggacgtgccggcgtcgctgttccaggagatccccgtctgtgtcg acggcgtcggcgggcagctccgcggcgcggccggggtggtccgggagctc ggcctgctccccgtcgccgaggtgtgagtgacttccaagtccagagttcg aacgcgagttgcttccatgccttttgctgaaatttactacgtatggttgg caaaaaatatttgcacttttcttggtagaaaaagagatatgagactatga gaggtacaaactatgagagatacagtcggggtgcgatctgcgatgtaatg tggggaattgcatatttgaagttcaataaaataaatcttttataagaaaa aaaaaa
Download
page-top