Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656950
Length 540 bp
Fasta Format > whgc8m24
attctgctcgtgagcgtaatggtataagcctgcctgactgtgagaccgac tggtcgaacagagacgaaagtcggccatagtgatccgggagtcccgtgtg gaagggctctcgctcaacggatcaaaggtacgccggggataacaggctga tgactcccaagagctcttatcgacggagtcgtttggcacctcgatgtcga ctcatcacatcctggggttgaagaaggtcccaagggttcggttgttcgcc gatgaaagtggtacgtgagttgggtttagaacgtcgtgagacagttcggt tcctatctaccgttggtgttaaagggagaactgcgaggagccagccctag tacgagaggactgggctgggtcaacctatggtgtaccggttgttatgcca atagcagcgccgggcagctaagttggtatggaagaactgctgcgccgcgg gaaatccttctctatacaagttctcgtacgaggtttttgaacagaacttc gataggcgagaaaaaaacaacaaataaactaaaaaaaaaa
Download
page-top