Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656815
Length 360 bp
Fasta Format > whgc8c20
atcctgaaggcccccaagtttgacctggggaagctcatggaggtgcacgg tgactacaaggaggatgttggtgtgaagcttgacaggcctgctgatggag atgaggtgattcctggagcggaggaggttgctgctgctgagtagaaaata gaagtcgctattttgctgcttcatatctagaagatgatatatgtgccacc tgggtgtcgtgaactttgtagtcagttttgatggctgatttcttgagtac ttctgtcgacattcctagccagcgttcagttatcttattttgttcgtgtt actttctggatggaggttatgagtttaaaactaaatatttagtttattcc aaaaaaaaaa
Download
page-top