Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656596
Length 703 bp
Fasta Format > whgc7e10
ggcacccagagacgaggaagggcgtagcaagcgacgaaatgcttcgggga gttgaaaataagcatagatccggagattcccaaataggtcaaccttttaa actgcctgctgaatccatgagcaggcaagagacaacctggcgaactgaaa catcttagtagccagaggaaaagaaagcaaaagcgattcccgtagtagcg gcgagcgaaatgggagcagcctaaaccgtgaaaacggggttgtgggagag caatacaagcgttgtgctgctaggcgaagcggttgagtgccgcaccctag atggctaaagtccagtagccgaaagcatcactagcttacgctctgacccg agtagcatggggcacgtggaatcccgtgtgaatcagcaaggaccaccttg caaggctaaatactcctgggtgaccgatagcgaagtagtaccgtgaggga aaggtgaaaagaacccccagtgggtagtgaaatagaacgtgaaaccgtgc tgagctcccaagcagtgggaggggaaagtgatctctgaccgcgtgcctgt tgaagaatgagccggcgactcataggcagtggcttggttaagggaacgga acccaccggagccgtagcgaaagcgagtcttaatagggcgattgtcactg cttatggacccgaacctgggtgatctatccatgaccaggatgaagcttgg atg
Download
page-top