Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656457
Length 575 bp
Fasta Format > whgc6l05
aattctccagtgatgaaataccccagatctggataggagatatcatagat gataaacaacaaaggagggcaccaagtggaacaatatttattcctacatc acagtttccccttaagaagacacgcaaggattgcacttacctgagtaccc cagcaatgaaaatcccggagacgatgcagaacgtccatgcctgtgagaat tggcttccaagaagggtgatgagcgcatggcgcattgctgggataataca tgctcaggaaggttggaacatgcatgagtgcggagatgatatgatggaca tcgaaaaggtttggtcggcggctattaggcacggattcattcctctgtca aaagcttgattcttctgaatcctgacagatatgttactcagcaacgatgc aaagttaagcttcagtgttaggagaataaggagtgttggatatgcttatc agcttgctagcttcattgagcagggtctacatatatctagatagaaagcc ataagtgtgatatatccataactactcataggtaatactgtatacatgta atttatgagtaatcaaattgtagaa
Download
page-top