Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656413
Length 691 bp
Fasta Format > whgc6i07
cttagctgcccggcgctgctattggcataacaaccggtacaccataggtt gacccagcccagtcctctcgtactagggctggctcctcgcagttctccct ttaacaccaacggtagataggaaccgaactgtctcacgacgttctaaacc caactcacgtaccactttcatcggcgaacaaccgaacccttgggaccttc ttcaaccccaggatgtgatgagtcgacatcgaggtgccaaacgactccgt cgataagagctcttgggagtcatcagcctgttatccccggcgtacctttg atccgttgagcgagagcccttccacacgggactcccggatcactatggcc gactttcgtctctgttcgaccagtcggtctcacagtcaggcaggcttata ccattacgctcacgagcagaatcaacgcttgagcctaccttcgcacacct ccgttactctttaggaggcatccgccccagataaactacccacctcgcag tgtcccgccccccccgaatgatcggtgcggcggttaggcatccttagacg aaagagtggtctttcaggattggtcgttgtgtgtcaccacctcccaccta tccnacacattcgatcaaggttgtcactgcgaagctatagtcaaggtgca cggggtcttaccgtctagccgttggtactccgcatcttcac
Download
page-top