Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656304
Length 639 bp
Fasta Format > whgc6a17
gatgtggctgtcctccttgacatgaggccatctatgacatctgccgccgc tcccttgacattgagcgcccaacatacaccaacctcaacaggctcgtttc tcaggtcatctcatccctgactgcttccctgaggtttgatggtgctctga atgttgatgtcaacgagttccagaccaacctggtgccctacccaagaatc cacttcatgctttcctcctacgccccagtgatctcagccgagaaggctta ccatgagcagctctctgttgccgagatcaccaacagcgccttcgagcctt cctccatgatggccaagtgtgacccccgccacggcaagtacatggcctgc tgcctcatgtaccgtggtgatgttgtgcccaaggatgtcaacgccgctgt ggccaccatcaagacgaagcgcaccatccagtttgtggactggtgcccca ctggtttcaagtgtggtatcaactaccagccacccagcgttgtcccaggc ggcgaccttgccaaggtccagagggccgtctgcatgatctccaactccac cagcgttgtcgaggtcttctcccgcatcgaccacaagttcgacctgatgt acgccaagcgtgccttcgtccactggtacgtgggtgagg
Download
page-top