Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ656251
Length 654 bp
Fasta Format > whgc5m17
gcctgggtgcttgacaagctcaaggccgagcgtgagagaggtatcaccat cgatattgccctctggaagtttgagacaaccaagtactactgcaccgtca ttgatgcccctggtcaccgtgacttcatcaagaacatgatcaccggtacc tcccaggctgactgtgctgttctcatcatcgactccaccactggtggttt tgaggctggtatctccaaggatggccagacacgtgagcacgccctccttg ctttcactcttggagtgaagcagatgatctgctgctgcaacaagatggac gccaccactcccaagtactcgaaggctcgttacgaagaaattgttaagga ggtctcttcgtacctgaagaaggtcggctacaaccctgacaaggttccct tcgtccccatctctgggttcgagggtgacaacatgattgagaggtccacc aaccttgactggtacaagggcccaaccctgcttgaggcacttgaccagat caacgagcccaagaggccctcagacaagcccctccgtcttcccctacagg atgtttacaagattggtggcattggaactgtgcctgttggccgtgttgag actggtgtcatcaagcctggtatggttgttacctttggtcccactggtct gaca
Download
page-top