Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ655573
Length 563 bp
Fasta Format > whgc2l15
ctcctgcgcctccacttccatcgcctcccaagatcgcagatctgctccgg tgagaatccgtcgccatgtcttccagcgaggtcgcctgcacccttgccgc cctcatcctccacgatgacgggatccccatcacttctgagaagatcgcga cggtggtgaaggctgccggaatcaaggttgaggcctactggcccgcgctc ttcgccaagctcctggagaagaggagcgtcgatgacctcatcctttccgt cggatctggtggaggtggtgctccagctgctgctgctgctgccccggctg ctggtggtgctgctgccgctgaagagaagaaagaagagaaaaaggaggag gctaaggaagagagcgatgatgacatgggcttcagcttgttcgactaagc agttcaattccagttctcctgtggaatcttttatgctaaggattacttat cttatgtgcttttaggtcgaattttgcggatttaatatgtttgagaccta agtatctgtgcaatgagtactgcaaaccaccttgggatggtctttttaga atgaaaaaaaaaa
Download
page-top