Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ289449
Length 659 bp
Fasta Format > whsl5g12
aggaattcggacgaggctcctcctcctccgccgccgccgccgcccctcgc ccagccagcccccatcaccggcgaagatgaagaccatcctggcgtcggag acgatggagatcccggaggaggtgaccgtgaaggtgtcggcgaagatgat ctcggtgacggggccgcgggggacgctgacccgcaacttcaagcacctca acctcgacttccagctgcaggagggcgggcgcaagctcaaggtggacgcc tggttcggcacccgcaagaccatggccgccatccgcaccgccatctccca cgtccagaacctcatcaccggggtcaccaagggcttccgctacaagatgc gcttcgtgtatgctcacttccccatcaacgcctccatcaccgccgccaac cggggcatcgagatcaggaacttcctcggcgagaagaaggtgaggaaggt ggacatgctcgacggggtcaccatcttgcggtccgagaaggtcaaggatg agatcgtcctcgacggcaatgacatcgagctcgtctcccgctccgccgcc ctcatcaaccagaaatgccacgtcaagaacaaggatatcaggaagttctt ggacggtatctacgtcagcgacaagggcgccatcaaggaggagtagagtg cgaaaaccg
Download
page-top