Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ655104
Length 755 bp
Fasta Format > whgc1l02
ctcttatcgacggagtcgtttggcacctcgatgtcgactcatcacatcct ggggttgaagaaggtcccaagggttcggttgttcgccgatgaaagtggta cgtgagttgggtttagaacgtcgtgagacagttcggttcctatctaccgt tggtgttaaagggagaactgcgaggagccagccctagtacgagaggactg ggctgggtcaacctatggtgtaccggttgttatgccaatagcagcgccgg gcagctaagttgctggcgggatcgacgatcatgcttttaaccatactttg gggatcttgtgttattgtcggtaaatgtgatctgtcagaggattcaacta caatcgattcccaggataccaaagccttcagtctttttggctctggtgtt tccactgatttgcagactagctatgcagcaagaatcatggcgatatctgt tctcccctttatcgttgttcagataccgcaaattctgaagctcaaatctg gtcatcgcttaactctactgcttgggcttatagttgcagtgctacttctg cttacttattgcctataccagatctttcagccatggatccagaggagaaa attagaatattcaaaactgaagcatgtaatgtctgggcttctgaaacatg ctcaaatgcatacttttggtcaccttatcgatgatgatggcacaccaaat gtttctgtcatagagaagttatttcacaaaaattgaatctggaacaatga tggaa
Download
page-top