Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ653030
Length 119 bp
Fasta Format > whgc11n02
cactctggatatggtaagcgtacgggtaccagggaggctaggctccccac caagatcctgtggatgcggaggatgcgcgtcctgangcgccttctgcgca agtaccgtgangccaagaa
Download
page-top