Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652842
Length 559 bp
Fasta Format > whgc10o20
atgcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggc caagaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagg gtaacatgttcaagaacaagagggtcctcatggagagtatccacaagtcc aaggctgagaaggcaagagagaagaccctctctgatcagtttgaggccaa gcgcgccaagagcaaggcaagcagggagaggaagcatgccaggagggagg agagattggctcagggccccagagatcatgcaccagcaccagcggctgca gctccagctccagcagcagcggcaccaaagaaggccaaggccaagaagtg aaggtctgacatgaagctttagctttctggtatcatgaagggttagcctg attttggagcatctgaagttcagaactgttttctgtgcaatatctgtgtg ccgcgtatgagataccttaaatatcatatcgtgtttgttctgttggatgt tgcttatgcagagtttctttaaacatttcggttcaccgaacctagtttta aaaaaaaaa
Download
page-top