Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652802
Length 704 bp
Fasta Format > whgc10l24
tcggctacaccctgacaggttcccttcgtccccatctctgggttcgaggg tgacaacatgattgagaggtccaccaaccttgactggtacaagggcccaa ccctgcttgaggcacttgaccagatcaacgagcccaagaggccctcagac aagcccctccgtcttcccctacaggatgtttacaagattggtggcattgg aactgtgcctgttggccgtgttgagactggtgtcatcaagcctggtatgg ttgttacctttggtcccactggtctgacaactgaggtcaagtccgttgag atgcaccatgagtctctcctggaggcgcttcctggtgacaacgttggctt caacgtcaagaacgttgccgtgaaggatctgaagcgtgggtttgttgcat ccaactccaaggatgaccctgccaaggaggcagccaacttcacctcccag gtcatcatcatgaaccaccctggtcagattggcaacggctacgccccagt gctggactgccacacctcacacattgctgtcaagtttgctgagctggtga ccaagatcgacaggcggtctggtaaggagctggaggccctgcccaagttc ctcaagaatggtgatgctggcatagtgaagatgattcccaccaagcccat ggttgtggagacctttgccacttaccctcctcttggtcgttttgctgtcc gtga
Download
page-top