Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652801
Length 659 bp
Fasta Format > whgc10l23
ggggagggggagagacgagttccgaaggggaacggaaaagaaagccaagc catctctcgcggaggcgaacgacaaggcttcctcccttgcgccctcgcag atcagttcagcggttctgctcctccggaccattgtgggtttgctgaaatg gagtcgcaaggtgatgacctgccaccaccaccaccactcccgccaaatgc agagccgataaaagctgagtcggctgatgacttgccactaccaccacccc tgccgcctatcanacctgaagaagcaaagaagatttcaaagcctaagagg gccctgattgctcgtcctggttttggcaagaggggaaatcctatacagct tgtgacaaatcatttcaaagtctcgttgaagacgacagatgagttcttcc accattactatgtaaatctgaagtatgaagatgacaggcctgttgatgga aaaggtgttggtagaaaagtcattgataagctttcacagacttatgcatc ggagctagcccataaagactttgcctatgatggtgaaaagagtcttttta ccattggtgccctcccacaaattaacaatgagtttgttgtggttcttgaa gacgtttccagtggaaagactcctgcaaatggcagccctggaaacgacag tccaggaaa
Download
page-top