Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652751
Length 462 bp
Fasta Format > whgc10h24
ccctcgcgcactcgccctccaacccaccgccgccgtcgacatgggtaagg tgcacggatcgctcgcccgtgccgggaaggtgcgcggccagacgcccaag gtcgcgaagcaggacaagaagaagcagccccgcggccgcgcccacaagag gatccagtacaaccgccgcttcgtcaccgccgtcgtcggcttcggcaaga agcgcggccccaactcctccgagaagtaggcgcgccgcaccgccgagcca agaaaaaggctcttcctttgcgctagttttcctctcgtttgttgttacgc aagattatgatgatggaagagacattactgaagtgttaaagtatgcatgt tttgcttagttgaagaatctgagatattgtggtatgggttcatggcttaa atttgcttgttgtttgtcgttgcccatgatgtgcaacatatgcgtctaga ttaaaaaaaaaa
Download
page-top