Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652726
Length 659 bp
Fasta Format > whgc10g09
gcagccattgaggactgggctgcacttaacggcaagtctggtgactacgc tgagttgtgcaatgatccgaaggcaaggaggtacatccaggatgagctga atcaaaccggcaagaaactcgggttgagaggatttgagatgctgagggcc gttcacctggagccagtgccattcagcatcgacaaggacctgatcacccc aacttttaagctcaagaggccccagctgctcaaacattacaaggatcgtg ttgatcagctgtacaaggatgccaagatgggaactgcacaatgaaaaatg gtggttaaacatcagcaagtggatatgagctttctgaatgtttcctcaag agtcaaaactagtatgatactatgatgtagcaacggtaaggaagttggct acggctcgaggcggtgacactttgtaccactactactgcattcaagaccc ggatccagcatagatctgcattcaaaagatacatgtcaaaataaaaatgt atttgcacataatgtgctactttttttttctcgagcgaacataatgtgct agttagagccggtaaagttatcttagcttgtaatccttactacaaacaag attaatggataactttgatatatataaaccactacnaagttaccgcttta aaaaaaaaa
Download
page-top