Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652719
Length 344 bp
Fasta Format > whgc10f18
acggcctcatctccttcgacgagttcaaggtcatgatggcctccggcttg gccgccaagatggcctgacccgtccatcctcttgttgattcagcgatttc gtccacgcctccctccctccttcctctcgcgtgccgtgcggtgcggtgcg gtgcggattaagtgcgaattaagtgtacataattcaaggattaaagggcg gccattagagtagattatttctttcgtttcttggtggtgcgagtaataac tagaaatctctcgcgaataactgtgtcgcgaatatcgatctgagatcaaa gagattgacgaggcttgaaggggatataaaaagcaaaaaaaaaa
Download
page-top