Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ652706
Length 602 bp
Fasta Format > whgc10e18
gcagcgatggagggcaaggaggaggacgtgcggctcggagcgaacaagta ctcggagcggcagcccatcggcacggcggcgcaggggtccgaggacaagg actacaaggagcccccgccggcgccgctgttcgagcccggcgagctcaag tcctggtccttctaccgcgccggcatcgccgagttcatggccaccttcct cttcctctacgtcaccatcctcaccgtgatgggctacagcggcgccacct ccaagtgcgccaccgtcggcatccagggcatcgcctggtccttcggcggc atgatcttcgccctcgtctactgcaccgccggcatctccggcgggcacat caacccggcggtgaccttcgggctgttcctggcgaggaagctgtcgctga ccagggcggtgttctacatcatcatgcagtgcctgggcgccatctgcggc gccggcgtggtgaaggggttccagcagggcctgtacatgggcaacggcng cggcnccaacntggtggcncccggctacaccaangnctccngcctcngnn ccnanatcatcnnnacctttntcctcntntannnnntcttctcnnnnann na
Download
page-top